/[Perly]/examples/Input/dna.txt
This is repository of my old source code which isn't updated any more. Go to git.rot13.org for current projects!
ViewVC logotype

Contents of /examples/Input/dna.txt

Parent Directory Parent Directory | Revision Log Revision Log


Revision 45 - (show annotations)
Sun Jun 8 18:09:07 2008 UTC (16 years ago) by dpavlin
File MIME type: text/plain
File size: 34 byte(s)
and examples
1 ACGGGAGGACGGGAAAATTACTACGGCATTAGC

  ViewVC Help
Powered by ViewVC 1.1.26